View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_57 (Length: 217)
Name: NF11092_low_57
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 33554538 - 33554342
Alignment:
| Q |
1 |
tttaagagattcgagtctagtttcactcggacgaacataatgnnnnnnnnnnnnnnnnnaagggaacggacgaacataatgttgataacgtacatttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554538 |
tttaagagattcgagtctagtttcactcggacgaacataatgttttttttttttttg---agggaacggacgaacataatgttgataacgtacatttgag |
33554442 |
T |
|
| Q |
101 |
tatataatgaagtgaaattatacctataaaataccttgaaggtgcattaaaaataaaaatcatgaaaaccctggcatgatgtatgattatatgtactttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554441 |
tatataatgaagtgaaattatacctataaaataccttgaaggtgcattaaaaataaaaatcatgaaaaccctggcatgatgtatgattatatgtactttt |
33554342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University