View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11092_low_60 (Length: 213)

Name: NF11092_low_60
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11092_low_60
NF11092_low_60
[»] chr8 (2 HSPs)
chr8 (52-197)||(37495599-37495747)
chr8 (78-110)||(16971826-16971858)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 52 - 197
Target Start/End: Original strand, 37495599 - 37495747
Alignment:
52 tttagagaaagt-atgatgttttattatataaactatattttagtccaactcattaatctcttaa-gtannnnnnnn-ctagatattcatatgtgaatct 148  Q
    |||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||| ||||| |||         ||||||||||||||||||||||    
37495599 tttagagaaagtcatgatgttttattatataaattatattttaatccaactcattaatcacttaaagtatttttttttctagatattcatatgtgaatct 37495698  T
149 aactacacttaatttgatctaactctcactaaaaaatgtataggtctct 197  Q
    ||||||||||||||||||||||||||||||| ||||| |||||||||||    
37495699 aactacacttaatttgatctaactctcactataaaatttataggtctct 37495747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 16971826 - 16971858
Alignment:
78 tataaactatattttagtccaactcattaatct 110  Q
    |||||||||||||| ||||||||||||||||||    
16971826 tataaactatatttcagtccaactcattaatct 16971858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University