View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11092_low_61 (Length: 204)
Name: NF11092_low_61
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11092_low_61 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 2112985 - 2112788
Alignment:
| Q |
1 |
caaaccttggctgctcaagagacattggataggttggtgagaatgaggagaaagatatgaacatgaacatgaacatgcatgttttgttacaccatttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2112985 |
caaaccttggctgctcaagagacattggcaaggttggtgagaatgaggagtaagatatgaacatgaacatg------catgttttgttacaccatttgtc |
2112892 |
T |
 |
| Q |
101 |
ttgttcatttacatttgaacttcatacatgacaccacttgtagtggagatgtaatgttactatggtaatgtagattgaataatgatcaaatttcgttctt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2112891 |
ttgttcatttacatttaaacttcatacatgacaccacttgtagtggagatgtaatgttactatggtaatgtagattgaataatgatcaaatttcgttctt |
2112792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University