View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_high_26 (Length: 298)
Name: NF11093_high_26
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 35 - 291
Target Start/End: Complemental strand, 30723054 - 30722790
Alignment:
| Q |
35 |
tacttgtaattgtatgtaaccgcgtaagtgtataatgaatatgaaatcttaaccaggctaaacagtcaatccgaacactagtttttaggaaaaggatgat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723054 |
tacttgtaattgtatgtaaccgcgtaagtgtataatgaatatgaaatcttaaccaggctaaacagtcaatccgaacactagtttttaggaaaaggatgat |
30722955 |
T |
 |
| Q |
135 |
gttatgcagtg--------ttcaaaatttggttgatttgcagtttttatttgaatgagtttggatattaagaggccatatatagtctctggagtatcttg |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30722954 |
gttatgcagtgatgcagtgttcaaaatttggttgatttgcagtttttatttgaatgagtttggatattaagaggccatatatagtctctggagtatcttg |
30722855 |
T |
 |
| Q |
227 |
taaaggatgatgttatatgcgcccatgtgaattgtttgcatgcactatgctagcttcctatgctt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||| |
|
|
| T |
30722854 |
taaaggatgatgttatatgcgcccatgtgaattgattgcatgcactatgctagctttctttgctt |
30722790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University