View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_high_39 (Length: 240)
Name: NF11093_high_39
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 44 - 187
Target Start/End: Complemental strand, 27670395 - 27670252
Alignment:
| Q |
44 |
taaaaaattagcttgaagcctttgcaagcaatagagaaacataaagacagtgaatcaaaatgaaaagaagagataccatcctaccaagcctttcgcttcc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27670395 |
taaaaaattagcttgaagcctttgcaagcaatagagaaacataaagacagggaatcaaaatgaaaagaagagataccatcctaccaagcctttcgcttcc |
27670296 |
T |
 |
| Q |
144 |
gtttgttagtcgaatttacatatgcatgaaaaattttgaacctg |
187 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
27670295 |
gtttgttagtcgaatttacctatgcatgaaaaagtttgaacctg |
27670252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 27670506 - 27670462
Alignment:
| Q |
1 |
tttggttttataacctcataatattttgcttgtagctaaatccta |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27670506 |
tttggttttataacctcataatattttgcttgtagctaaatccta |
27670462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 41802831 - 41802778
Alignment:
| Q |
123 |
cctaccaagcctttcgcttccgtttgttagtcgaatttacatatgcatgaaaaa |
176 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
41802831 |
cctaccaagcctttcacttccagttgttagtaaaatttacatatgcaagaaaaa |
41802778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University