View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_high_43 (Length: 228)
Name: NF11093_high_43
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_high_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 80 - 226
Target Start/End: Complemental strand, 32083592 - 32083445
Alignment:
| Q |
80 |
tgtgatgacaaattagtttttgaaaaatgtcaatttttggg-tacctaaaaataaataggtaaactggtcaattttcaatatgtttcatatgatcatagc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32083592 |
tgtgatgacaaattagtttttgaaaaatgtcaatttttggggtacctaaaaataaataggtaaactggtcaattttcaatatgtttcatatgatcatagc |
32083493 |
T |
|
| Q |
179 |
tgaccaatggattcacgttgtcaaaatcttcaaaatggatacatggtt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32083492 |
tgaccaatggattcacgttgtcaaaatcttcaaaatggatacatggtt |
32083445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 32083692 - 32083641
Alignment:
| Q |
6 |
agtttatatatgtcatcggatcattggaaaattttagcgatttcgaaaatgt |
57 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
32083692 |
agtttatatatgtcatcagatcattggaaaattttagcgattttgaaaatgt |
32083641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University