View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_high_44 (Length: 227)
Name: NF11093_high_44
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_high_44 |
 |  |
|
| [»] scaffold0312 (1 HSPs) |
 |  |  |
|
| [»] scaffold1379 (1 HSPs) |
 |  |  |
|
| [»] scaffold0536 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 24)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 49 - 173
Target Start/End: Original strand, 32083262 - 32083386
Alignment:
| Q |
49 |
ctcttggctctaccaacctgtacacatttgnnnnnnnnnnnattctctaaaatcatgtagcggattctagcagtcaaacaatcaacaacaaattttcact |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32083262 |
ctcttggctctaccaacctgtacacatttgtttttttttttattctctaaaatcatgtagcgcattctagcggtcaaacaatcaacaacaaattttcact |
32083361 |
T |
 |
| Q |
149 |
agtcacattccaagtccgattctaa |
173 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
32083362 |
agtcacattccaggtccgattctaa |
32083386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 11819112 - 11819061
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11819112 |
acaaatcggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
11819061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 1075004 - 1075044
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1075004 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
1075044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 30156388 - 30156432
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30156388 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
30156432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 36691906 - 36691950
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36691906 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
36691950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 39610226 - 39610182
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39610226 |
ggaggggtgattattgggtcaaaattgaccataaatcacccctct |
39610182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 32080854 - 32080901
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32080854 |
acaaatcggaggggtgatttttgggtcaaaattgaccctaaatcaccc |
32080901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 48652540 - 48652591
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
48652540 |
acaaatcggaggggtgatttttgggtcaaagttgaccctaaatcacccctct |
48652591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 31462855 - 31462897
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31462855 |
aggggtgatttttgggtcaaaattgaccctaaatcacccctct |
31462897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 3456965 - 3456921
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3456965 |
ggagaggtgatttttggatcaaaattgaccataaatcacccctct |
3456921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 4206618 - 4206662
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
4206618 |
ggaggggtgattttttgatcaaaattgaccataaatcacccctct |
4206662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 53155541 - 53155581
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53155541 |
gggtgatttttgggtcaaaattgaccctaaatcacccctct |
53155581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 34960966 - 34961009
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
34960966 |
gaggggtgatttttgggtcaaaattgaccctaagtcacccctct |
34961009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 13702081 - 13702123
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
13702081 |
aggggtgacttttgggtcaaaattgaccctaaatcacccctct |
13702123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 31270346 - 31270308
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31270346 |
aggggtgatttttgggtcaaaattgaccctaaatcaccc |
31270308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 48400915 - 48400877
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48400915 |
gtgatttttgggtcaaaattgaccctaaatcacccctct |
48400877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 14585483 - 14585440
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14585483 |
gaggagtgatttttgggtcaaaattgactctaaatcacccctct |
14585440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 50
Target Start/End: Original strand, 40883983 - 40884018
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40883983 |
tgatttttgggtcaaaattgaccctaaatcacccct |
40884018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 55090683 - 55090734
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
55090683 |
acaaatcggaggggtgatttttgggttgaaattaaccctaaatcacccctct |
55090734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 48854935 - 48854889
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacc |
47 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
48854935 |
acaaatcggaggggtgatttttgggttaaaattgacccaaaatcacc |
48854889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 46
Target Start/End: Complemental strand, 53402648 - 53402614
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcac |
46 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
53402648 |
gggtgatttttgggtcaaaattgaccttaaatcac |
53402614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 51
Target Start/End: Complemental strand, 54706815 - 54706777
Alignment:
| Q |
13 |
ggtgatttttgggtcaaaattgaccataaatcacccctc |
51 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
54706815 |
ggtgatttttgggtcaaaattgaccttaaattacccctc |
54706777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 19861388 - 19861428
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
19861388 |
gggtgatttttgagtcaaaattgaccctaaatcacctctct |
19861428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 49628195 - 49628239
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattga-ccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
49628195 |
gaggggtgatttttaggtcaaaattgacccaaaaatcacccctct |
49628239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 41361761 - 41361712
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361761 |
acaaatcggaggggtgatttttgggtcaaaattgaccataaatcacccct |
41361712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 1810321 - 1810370
Alignment:
| Q |
3 |
aaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1810321 |
aaatcggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
1810370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 37612675 - 37612631
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37612675 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
37612631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 2025309 - 2025360
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2025309 |
acaacttggaagggtgattttttggtcaaaattgaccataaatcacccctct |
2025360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 52
Target Start/End: Original strand, 24791282 - 24791319
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24791282 |
tgatttttgggtcaaaattgaccataaatcacccctct |
24791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 10147968 - 10147924
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10147968 |
ggaggggtgattattgggtcaaaattgaccctaaatcacccctct |
10147924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 11161911 - 11161860
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
11161911 |
acaacttgaaggggtgatttttgggtcaaaattgaccctaaattacccctct |
11161860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 39067802 - 39067841
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39067802 |
gtgatttttgggtcaaaattgaccttaaatcacccctctt |
39067841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 52
Target Start/End: Original strand, 31407862 - 31407899
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31407862 |
tgatttttgggtcaaaattgaccctaaatcacccctct |
31407899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 7583875 - 7583915
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
7583875 |
gggtgatttttgggtcaaaattgatcctaaatcacccctct |
7583915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 10338929 - 10338969
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
10338929 |
ggaggggtgatttttgcgtcaaaattgaccttaaatcaccc |
10338969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 24699848 - 24699812
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24699848 |
gggtgatttttgggtcaaaattgaccctaaatcaccc |
24699812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 30026991 - 30027031
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
30026991 |
gggtgatttttgggtcaaaaatgaccctaaatcacccctct |
30027031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 31202487 - 31202440
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||| ||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
31202487 |
acaatttggatggatgatttttgggtcaaaattgaccttaaatcaccc |
31202440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 10042792 - 10042748
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaa-ttgaccataaatcacccctctt |
53 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
10042792 |
gaggggtgatttt-gggtcaaaaattgaccataaatcacccctctt |
10042748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 52
Target Start/End: Original strand, 14600812 - 14600849
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
14600812 |
tgatttttgggtcaaaattgaccctaaatcacctctct |
14600849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 7583964 - 7584000
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatc |
44 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
7583964 |
ggaggggtgatttttgggtcataattgaccctaaatc |
7584000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 31308164 - 31308120
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
31308164 |
ggagaggtgatttttagatcaaaattgaccttaaatcacccctct |
31308120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 17)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 6281065 - 6281022
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6281065 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
6281022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 17331357 - 17331306
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17331357 |
acaaatcggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
17331306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 52
Target Start/End: Complemental strand, 28040653 - 28040607
Alignment:
| Q |
6 |
ttggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28040653 |
ttggaggggtgatttttgggtcaaaattgaccgtaaatcacccctct |
28040607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 7771905 - 7771949
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7771905 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
7771949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 29097818 - 29097769
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
29097818 |
acaaatcggaggggtgatctttgggtcaaaattgaccctaaatcacccct |
29097769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 17096341 - 17096385
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
17096341 |
ggaggggtgattattgggtcaaaattgaccctaaatcacccctct |
17096385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 32347814 - 32347858
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
32347814 |
ggaggggtgatttttgggtcaaagttgaccctaaatcacccctct |
32347858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33164567 - 33164611
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33164567 |
ggaggagtgatttttgagtcaaaattgaccataaatcacccctct |
33164611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 27241085 - 27241046
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27241085 |
gaggggtgatttttgggtcaaaattgatcataaatcaccc |
27241046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 17699575 - 17699537
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17699575 |
ggaggggtgatttttgggtcaaaattgaccctaaatcac |
17699537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 26295157 - 26295201
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
26295157 |
ggaggggtgatttttggatcaaaattgaccctaaatcacctctct |
26295201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 43493894 - 43493850
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
43493894 |
ggagaggtgatttttggatcaaaattgaccctaaatcacccctct |
43493850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 51
Target Start/End: Complemental strand, 20483204 - 20483165
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctc |
51 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
20483204 |
gggtgatttttgggtcaaaattgatcctaaatcacccctc |
20483165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 34431078 - 34431045
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatca |
45 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
34431078 |
gggtgatttttgggtcaaaattgaccctaaatca |
34431045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 6635267 - 6635227
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| |||||| |
|
|
| T |
6635267 |
gggtgatttttgggtcaaaattggccctaaatcatccctct |
6635227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 6887261 - 6887305
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
||||||||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
6887261 |
gaggggtgattttgggttaaaaattgaccctaaatcacccctctt |
6887305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 28618635 - 28618591
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
||||||||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
28618635 |
gaggggtgattttgggttaaaaattgaccttaaatcacccctctt |
28618591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 28)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 52
Target Start/End: Original strand, 12891186 - 12891232
Alignment:
| Q |
6 |
ttggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12891186 |
ttggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
12891232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 11937958 - 11938002
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11937958 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
11938002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 20561231 - 20561275
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20561231 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
20561275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 32015242 - 32015198
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32015242 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
32015198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 44942307 - 44942267
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44942307 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
44942267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 9978761 - 9978812
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9978761 |
acaatttgaaggggtgatttttgggtcaaaattgaccttaaatcacccctct |
9978812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 25067881 - 25067830
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25067881 |
acaaatcggaggggtgatttttgggtcaaaattgaccctaaatcacctctct |
25067830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 12704707 - 12704665
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12704707 |
aggggtgatttttgggtcaaaattgaccctaaatcacccctct |
12704665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 17268225 - 17268267
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17268225 |
agggatgatttttgggtcaaaattgaccataaatcacccctct |
17268267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 5754310 - 5754266
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5754310 |
ggagggatgatttttgggtcaaaattgaccctaaatcacccctct |
5754266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 9690072 - 9690116
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
9690072 |
ggaggggtgatttttgggtcaaatttgaccttaaatcacccctct |
9690116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 15919896 - 15919852
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15919896 |
ggaggggtgatttttgggtcaaaattgactctaaatcacccctct |
15919852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 22597157 - 22597113
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22597157 |
ggagggatgatttttgggtcaaaattgaccttaaatcacccctct |
22597113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 43474231 - 43474271
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43474231 |
gggtgatttttgggtcaaaattgaccctaaatcacccctct |
43474271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 36868029 - 36867986
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
36868029 |
gaggggtgatttttgagtcaaaattgaccctaaatcacccctct |
36867986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 38535406 - 38535448
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
38535406 |
aggggtgctttttgggtcaaaattgaccctaaatcacccctct |
38535448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 7073055 - 7073091
Alignment:
| Q |
16 |
gatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7073055 |
gatttttgggtcaaaattgaccctaaatcacccctct |
7073091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 13879113 - 13879157
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
13879113 |
ggaggggtgattattgggtcaaaattgaccctaaatcatccctct |
13879157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 14019238 - 14019282
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
14019238 |
ggaggggtgattattgggtcaaaattgaccctaaatcatccctct |
14019282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 18089491 - 18089535
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
18089491 |
ggaggagtgatttttggatcaaaattgaccctaaatcacccctct |
18089535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 27095727 - 27095687
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
27095727 |
ggaggggtgatttttaggtcaaaattgaccctaaatcaccc |
27095687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 46
Target Start/End: Original strand, 11798615 - 11798653
Alignment:
| Q |
7 |
tggaggggtgatttttgggtcaaaattgaccataaatcac |
46 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11798615 |
tggaggggtgatttt-gggtcaaaattgaccataaatcac |
11798653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 48
Target Start/End: Complemental strand, 28231239 - 28231200
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
28231239 |
gaggggtgatttttgggttaaaattgaccctaaatcaccc |
28231200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 38384534 - 38384585
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38384534 |
acaaatcggagatgtgatttttgggtcaaaattgacccaaaatcacccctct |
38384585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 41797636 - 41797593
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
41797636 |
gaggggtgatttttaggtcaaaattaaccctaaatcacccctct |
41797593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 41841980 - 41841937
Alignment:
| Q |
10 |
aggggtgatttttgggtc-aaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
41841980 |
aggggtgatttttgggtcaaaaattgaccataaatcaaccctct |
41841937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Original strand, 28261998 - 28262032
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
28261998 |
gtgatttttgggtcaaaattgaccctaaatcaccc |
28262032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 33012093 - 33012059
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
33012093 |
gtgatttttgggtcaaaattgaccctaaatcaccc |
33012059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 22747599 - 22747648
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22747599 |
acaacttggaggggtgatttttgggtcaaaattgaccctaaatcacccct |
22747648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 11833037 - 11832996
Alignment:
| Q |
11 |
ggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11833037 |
ggggtgatttttgggtcaaaattgaccataaatcatccctct |
11832996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 10 - 50
Target Start/End: Complemental strand, 9785337 - 9785297
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9785337 |
aggggtgatttttgggtcaaaattgaccctaaatcacccct |
9785297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 40761611 - 40761567
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40761611 |
ggaggggtgatttttgggtcaaaattgaccctaaatcatccctct |
40761567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 42603868 - 42603912
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
42603868 |
ggaggggtgatttttgagtcaaaattgaccataaatcaccgctct |
42603912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 48304498 - 48304538
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48304498 |
gggtgatttttgggtcaaaattgaccctaaatcacccctct |
48304538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 46026134 - 46026172
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46026134 |
gtgatttttgggtcaaaattgaccctaaatcacccctct |
46026172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 6667414 - 6667373
Alignment:
| Q |
11 |
ggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
6667414 |
ggggtgatttttgggtcaaaattgaccctaaatcactcctct |
6667373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 17473822 - 17473863
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccc |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17473822 |
ggaggggtgattttttggtcaaaattgaccctaaatcacccc |
17473863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 17579392 - 17579351
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccc |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
17579392 |
ggaggggtgattttttggtcaaaattgaccctaaatcacccc |
17579351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 53
Target Start/End: Original strand, 36579411 - 36579456
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
36579411 |
ggaggggtgattttcgggtcaaaattgaccctaaatcatccctctt |
36579456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 3266404 - 3266360
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
3266404 |
ggagggatgattattggatcaaaattgaccataaatcacccctct |
3266360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 10574403 - 10574363
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
10574403 |
ggaggggtgatttttgagtcaaaattgaccctaaatcaccc |
10574363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 21990683 - 21990639
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
21990683 |
ggaggggtgatttttcagtcaaaattgaccctaaatcacccctct |
21990639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 28665011 - 28665051
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
28665011 |
ggaggggtgattttagggtcaaaattgaccctaaatcaccc |
28665051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 36719640 - 36719680
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
36719640 |
ggaggggtgatttttggatcaaaattgaccctaaatcaccc |
36719680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 41287975 - 41287935
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
41287975 |
gggtgattattgggtcaaaattgaccctaaatcacccctct |
41287935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 45457655 - 45457699
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
45457655 |
ggaggagtgatttttgcgtcaaaattgaccctaaatcacccctct |
45457699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 45482086 - 45482042
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
45482086 |
ggaggggtgattttggggtcaaaattgaccctaaatcactcctct |
45482042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 5684387 - 5684345
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5684387 |
ggagaggtgatttttgcgtcaaaattgaccctaaatcacccct |
5684345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 5709437 - 5709395
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5709437 |
ggagaggtgatttttgcgtcaaaattgaccctaaatcacccct |
5709395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 39533081 - 39533114
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
39533081 |
tgatttttgggtcaaaattgaccctaaatcaccc |
39533114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 47749765 - 47749721
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaa-ttgaccataaatcacccctctt |
53 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
47749765 |
gaggggtgatttt-gggtcaaaaattgaccataaatcacccctctt |
47749721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 17221685 - 17221642
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
17221685 |
gaggggtgatttttgg-tcaaaattcactataaatcacccctctt |
17221642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 17509306 - 17509346
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
17509306 |
gggtgattttttggtcaaaattgaccctaaatcatccctct |
17509346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 17543908 - 17543868
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
17543908 |
gggtgattttttggtcaaaattgaccctaaatcatccctct |
17543868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 24988454 - 24988497
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
24988454 |
ggaggggtgatttt-gggtcaaaattgaccctgaatcacccctct |
24988497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Complemental strand, 27535474 - 27535434
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
27535474 |
gggtgatttttggataaaaattgaccctaaatcacccctct |
27535434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0312 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0312
Description:
Target: scaffold0312; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 6159 - 6115
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6159 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
6115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 17)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 424390 - 424434
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
424390 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
424434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 12871643 - 12871599
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12871643 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
12871599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33487129 - 33487173
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33487129 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
33487173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 33939102 - 33939145
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33939102 |
gaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
33939145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 32784130 - 32784088
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32784130 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccct |
32784088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 7995659 - 7995703
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7995659 |
ggagaggtgatttttgggtcaaaattgaccctaaatcacccctct |
7995703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 20411591 - 20411555
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20411591 |
gggtgatttttgggtcaaaattgaccataaatcaccc |
20411555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 18343643 - 18343592
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
18343643 |
acaaatcgaaggggtgatttttgggtcaaaattgatcctaaatcacccctct |
18343592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 27534728 - 27534677
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27534728 |
acaaatcggagggatgatttttgggtcaaaattgaccctaaatcatccctct |
27534677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 28678235 - 28678273
Alignment:
| Q |
14 |
gtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28678235 |
gtgatttttgggtcaaaattgaccctaaatcacccctct |
28678273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 48
Target Start/End: Complemental strand, 29205305 - 29205267
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29205305 |
aggggtgatttttgggtcaaaattgaccctaaatcaccc |
29205267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 45750493 - 45750456
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45750493 |
tgatttttgggtcaaaattgaccttaaatcacccctct |
45750456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 13488628 - 13488675
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
13488628 |
acaaatcggatgggtgatttttgggtcaaaatcgaccctaaatcaccc |
13488675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 22032172 - 22032217
Alignment:
| Q |
9 |
gaggggtgatttttgggtc-aaaattgaccataaatcacccctctt |
53 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
22032172 |
gaggggtgatttttgggtcaaaaattgaccctaaatcatccctctt |
22032217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 3232810 - 3232770
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
3232810 |
ggaggggtgattttttgatcaaaattgaccctaaatcaccc |
3232770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 14265306 - 14265266
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
14265306 |
ggaggggtgatttttttgtcaaaattgaccctaaatcaccc |
14265266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 42490915 - 42490871
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| ||||||| |||||| ||||||||| |||| |
|
|
| T |
42490915 |
ggaggggtgatttttaggtcaaacttgaccctaaatcacctctct |
42490871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 12481462 - 12481513
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
12481462 |
acaaatcggaggggtgatttttgggtcaaaattgatcctaaatcacccctct |
12481513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 15590179 - 15590222
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15590179 |
gaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
15590222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 21507900 - 21507951
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
21507900 |
acaatttggaggggtgatgtttgggtcaaaattgaccctaaatcacccctct |
21507951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 35219995 - 35220045
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctc |
51 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35219995 |
acaacttggaggggtgatttttgagtcaaaattgaccctaaatcacccctc |
35220045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 29927471 - 29927516
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcac |
46 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29927471 |
acaacttggaggagtgatttttgggtcaaaattgaccataaatcac |
29927516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 8693763 - 8693803
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8693763 |
gggtgatttttgggtcaaaattgaccttaaatcacccctct |
8693803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 6419958 - 6420001
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6419958 |
gaggggtgatttttggatcaaaattgaccctaaatcacccctct |
6420001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 23654279 - 23654228
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
23654279 |
acaaatcggatgggtgatttttgggtcaaaattgaccctaaatcacctctct |
23654228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 14783270 - 14783314
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14783270 |
ggaggcgtgatttttgggtcaaaattgaccctaaatcagccctct |
14783314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Original strand, 31937517 - 31937557
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
31937517 |
ggaggggtgatttttgggtcaaaactgaccctaaatcaccc |
31937557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Original strand, 4921982 - 4922023
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
4921982 |
ggaggggt-atttttgggtcaaaattgaccctaaatcacccct |
4922023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 4085033 - 4084996
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4085033 |
tgatttttcggtcaaaattgaccctaaatcacccctct |
4084996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 28)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 394373 - 394416
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
394373 |
ggaggggtgatttttgggtcaaaattgaccctaaatcacccctc |
394416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 478115 - 478154
Alignment:
| Q |
13 |
ggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
478115 |
ggtgatttttgggtcaaaattgaccataaatcacccctct |
478154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 24611899 - 24611942
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24611899 |
gaggggtgatttttgggtctaaattgaccataaatcacccctct |
24611942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 43244481 - 43244524
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43244481 |
gaggggtgatttttgggtcaaaattgaccctaaatcacccctct |
43244524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 50
Target Start/End: Complemental strand, 8712551 - 8712510
Alignment:
| Q |
9 |
gaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8712551 |
gaggggtgatttttgggtcaaaattgaccctaaatcacccct |
8712510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 29268876 - 29268920
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
29268876 |
ggaggggtgattttagggtcaaaattgaccttaaatcacccctct |
29268920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 44757145 - 44757185
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44757145 |
gggtgatttttgggtcaaaattgaccttaaatcacccctct |
44757185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 6911709 - 6911658
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
6911709 |
acaaatcggagaggtgatttttggatcaaaattgaccctaaatcacccctct |
6911658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 51152147 - 51152105
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
51152147 |
ggaggggtgatttttgggtcaatattgaccntaaatcacccct |
51152105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 12 - 50
Target Start/End: Complemental strand, 27394848 - 27394810
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27394848 |
gggtgatttttgggtcaaaattgaccctaaatcacccct |
27394810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 30202058 - 30202016
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
30202058 |
aggggtgatttttggatcaaaattgaccttaaatcacccctct |
30202016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 31522004 - 31521962
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
31522004 |
ggaggggtgatttttaggtcaaaattgaccctaaatcacccct |
31521962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 39837614 - 39837572
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39837614 |
aggggtgatttttgggtcaaaattgacgctaaatcacccctct |
39837572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 7060346 - 7060302
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
7060346 |
ggaggggtgatttttgggttaaaattgaccctaaattacccctct |
7060302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 11210412 - 11210456
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
11210412 |
ggaggggtgatttttagggcaaaattgaccctaaatcacccctct |
11210456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 22757116 - 22757072
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
22757116 |
ggagtggtgatttttgagtcaaaattgaccctaaatcacccctct |
22757072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 24568816 - 24568856
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
24568816 |
gggtgatttttgggtcaaaattcaccctaaatcacccctct |
24568856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 13965580 - 13965545
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatca |
45 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13965580 |
aggggtgatttttgggtcaaaattgaccctaaatca |
13965545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 25658196 - 25658145
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||| ||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
25658196 |
acaatttggagaggtgatttttgagtcaaaattaaccctaaatcacccctct |
25658145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 29922863 - 29922812
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||| ||||||||| |||| |
|
|
| T |
29922863 |
acaacttggaggggtgattattaggtcaaaattgaccctaaatcacctctct |
29922812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 5814376 - 5814330
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgaccataaatcacc |
47 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
5814376 |
acaacttggagggatgatttttggatcaaaattgaccctaaatcacc |
5814330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 6 - 48
Target Start/End: Complemental strand, 26674396 - 26674354
Alignment:
| Q |
6 |
ttggaggggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
||||||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
26674396 |
ttggaggggtgatttttaggtcaaaattgatcctaaatcaccc |
26674354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 52
Target Start/End: Complemental strand, 39523433 - 39523396
Alignment:
| Q |
15 |
tgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39523433 |
tgatttttgggtcaaaattgactctaaatcacccctct |
39523396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 626650 - 626690
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
626650 |
gggtgatttttgggtcaaaattagccctaaatcacccctct |
626690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 20400006 - 20400038
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatc |
44 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
20400006 |
gggtgatttttgggtcaaaattgaccctaaatc |
20400038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 24825671 - 24825627
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||| ||||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
24825671 |
ggaggagtgatttttaggtcaaaattgatcctaaatcacccctct |
24825627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 48
Target Start/End: Original strand, 26742566 - 26742602
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcaccc |
48 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| |
|
|
| T |
26742566 |
gggtgatttttgggtcaaaattgatcctaaatcaccc |
26742602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 38944239 - 38944275
Alignment:
| Q |
1 |
acaaattggaggggtgatttttgggtcaaaattgacc |
37 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
38944239 |
acaatttggaggggtgatttttgggccaaaattgacc |
38944275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1379 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold1379
Description:
Target: scaffold1379; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 1187 - 1229
Alignment:
| Q |
10 |
aggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1187 |
aggggtgatttttgggtcaaaattgaccttaaatcacccctct |
1229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0536 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0536
Description:
Target: scaffold0536; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 2922 - 2878
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
2922 |
ggaggggtgattattgggtcaaaattgaccctaaatcacccctct |
2878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 13348 - 13392
Alignment:
| Q |
8 |
ggaggggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
13348 |
ggaggggtgatttttggatcaaaattgaccctaaatcacctctct |
13392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 47
Target Start/End: Complemental strand, 35100 - 35065
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacc |
47 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35100 |
gggtgatttttgggtcaaaattgaccctaaatcacc |
35065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0432 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 50
Target Start/End: Original strand, 2519 - 2557
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccct |
50 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
2519 |
gggtgatttttgggtcaaaaatgaccctaaatcacccct |
2557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 52
Target Start/End: Original strand, 404361 - 404401
Alignment:
| Q |
12 |
gggtgatttttgggtcaaaattgaccataaatcacccctct |
52 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||| |
|
|
| T |
404361 |
gggtgatttttggatcaaaattgaccttaaatcgcccctct |
404401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University