View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_high_45 (Length: 206)
Name: NF11093_high_45
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 191
Target Start/End: Complemental strand, 32882432 - 32882260
Alignment:
| Q |
19 |
ccaattagaaagaaaatcaaacnnnnnnnnncaatgagagaattgaaattgaacagatacattgaaagccacgtcacacctgatcttgtaacactgataa |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32882432 |
ccaattagaaagaaaatcaaacaaaaaaaaccaatgagaaaattgaaattgaacagatacattgaaagccacgtcacacctgatcttgtaacactgataa |
32882333 |
T |
|
| Q |
119 |
agttgaagagtactctctcggaatcactttttgcgaagcaatgaattgtccagctttcacataaaaccctttg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32882332 |
agttgaagagtactctctcggaatcactttttgcgaagcaatgaattgtccagctttcacataaaaccctttg |
32882260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University