View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_low_11 (Length: 477)
Name: NF11093_low_11
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 202 - 457
Target Start/End: Original strand, 45248647 - 45248906
Alignment:
| Q |
202 |
atatatatcgctatgttcatatcaactaagctatgttcgtatcagcgtttaacatttgaacatttgaaactttcttcggcaaaataagggtaattttaca |
301 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45248647 |
atatatatcgtgatgttcatatcaactaagctatgttcgtatcagcgtttaacatttgaacatttgaaactttcttcggcaaaataagggtaattttaca |
45248746 |
T |
|
| Q |
302 |
tt----gtccctctccacattttgtcagtgtaattttacaaaatgctttatctacatttatttacataattgaatataagggttcctttcatagtttcat |
397 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45248747 |
ttaattgtccctctccacattttgtcagtgtaattttacaaaatgctttatctacatttatttacataattgaatataagggttcctttcatagtttcat |
45248846 |
T |
|
| Q |
398 |
gtatgcattttattctgctggtaccacttttgtattggttaaatgtatgattgattctgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45248847 |
gtatgcattttattctgctggtaccacttttgtattggttaaatgtatgattgcttctgt |
45248906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 45248346 - 45248572
Alignment:
| Q |
1 |
aagtttgcatgcttgtcttctgtgtttcttgccattactcatttttctcaagctgcaatttaaaatacactatattgtctaatgcataacataaagtccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45248346 |
aagtttgcatgcttgtcttctgtgtttcttgccattactcatttttctcaagctgcaatttaaaatacactatattgtctaatgcataacataaagtccc |
45248445 |
T |
|
| Q |
101 |
actatggcactaacataacagcttttgtcatcattatcaagccaactttgtctaaatgtttaaagcatttgacaactgcagtatagaaaagcaactaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
45248446 |
actatggcactaacataacagcttttgtcatcattatcaagccaactttgtctaaatgtttaaagcatttgacaaccgcagtaaagaaaagcaactaagc |
45248545 |
T |
|
| Q |
201 |
tatatatatcgctatgttcatatcaac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45248546 |
tatatatatcgctatgttcatatcaac |
45248572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University