View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_low_17 (Length: 390)
Name: NF11093_low_17
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 305
Target Start/End: Complemental strand, 30258118 - 30257831
Alignment:
| Q |
18 |
cttatgtacagaatctaatcactgaatccagattttgagaaatggaacatttctgatgtctgcagaaaaccatcaaatgtgcttgtacccttttctgcac |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30258118 |
cttatgtacagaatctaatcactgaattcagattttgagaaatagaacatttctgatgtctgcagaaaaccatcaaatgtgcttgtacccttttctgcac |
30258019 |
T |
 |
| Q |
118 |
gtctcataaatttcgtgaacttcactttgcatgaacgtgaggctcagagtaaatattctaacctgtgctctatgtgcaaagaaatgcaccaaatcacgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30258018 |
gtctcataaatttcgtgaacttcactttgcatgaacgtgaggctcagagtaaatattctaacctgtgctctatgtgcaaagaaatgcaccaaatcacgtg |
30257919 |
T |
 |
| Q |
218 |
gatttaacaccgcttcctattaaagatgtaaattcctatcacgagttatggaataattatatagtgcatcaacattttggtattgtct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30257918 |
gatttaacaccgcttcctattaaagatgtaaattcctatcacgagttatggaataattatatagtgcatcaacattttggtattgtct |
30257831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 294 - 383
Target Start/End: Complemental strand, 30257619 - 30257530
Alignment:
| Q |
294 |
ttggtattgtctcttaagtgcatcttatatagtaaattgatatgttaggaggtggagttatactcacaatactcttcttttttcttctca |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30257619 |
ttggtattgtctcttaagtgcatcttatatagtaaattgatatgttaggaggtggagttaaactcacaatactcttcttttttcttctca |
30257530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University