View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11093_low_33 (Length: 253)
Name: NF11093_low_33
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11093_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 234
Target Start/End: Original strand, 42712482 - 42712708
Alignment:
| Q |
8 |
agagaagaaaatggctggaacaatgaacgagattgattgcttcaacttatttgacaacattgatgacatttaccccgtcgacgacgttgacaccgctgcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42712482 |
agagaagaaaatggctggaacaatgaacgagattgattgcttcaacttatttgacaacattgatgacatttaccccgtcgacgatgttgacaccgctgcc |
42712581 |
T |
 |
| Q |
108 |
gcctcattgccttcctccgcgggaaactacaactcgttggcgagtatctggccgaatgagtctgactcggttttttccggcaatagtacttcagacctct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42712582 |
gcctcattgccttcctccgcgggaaactacaactcgttggcgagtatctggccgaatgagtctgactcggttttttccggcaatagtacttcagacctct |
42712681 |
T |
 |
| Q |
208 |
cggcggagctccccgttgatccggtga |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42712682 |
cggcggagctccccgttgatccggtga |
42712708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University