View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11094_high_15 (Length: 253)
Name: NF11094_high_15
Description: NF11094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11094_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 23 - 240
Target Start/End: Original strand, 24975134 - 24975351
Alignment:
| Q |
23 |
attccaatggattcaagagccattattggcttagtttaaaattaaatctatttcacttggttctaagaattcgccacccccttctcccaattgaatcctt |
122 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24975134 |
attccaatggattcaagaaccattattggcttagtttaaaattaaatctatttcacttggttctaagaattcgccacccccttctcccaattgaaccctt |
24975233 |
T |
|
| Q |
123 |
cttggttaaaaccatattacaaccaacatctctaacatttttataaatatgattttgttaaaatttcttttaactaatccaaatttgccacgaatgcaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24975234 |
cttggttaaaaccatattacaaccaacatctctaacatttttataaatatgattttgttaaaatttcttttaactaatccaaatttgccacgaatgcaac |
24975333 |
T |
|
| Q |
223 |
gattctaagatgccgtct |
240 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
24975334 |
aattctaagatgtcgtct |
24975351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University