View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11094_high_18 (Length: 234)
Name: NF11094_high_18
Description: NF11094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11094_high_18 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 39299888 - 39300105
Alignment:
| Q |
17 |
tttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtc |
116 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299888 |
tttgaaccaagttcatggctctctctttctcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtc |
39299987 |
T |
|
| Q |
117 |
caactacatttgtagcatgatgacgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgtttgtgtccaaggttggtagcagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||| |
|
|
| T |
39299988 |
caactacatttgtagcatgatgacgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgcttgtgaccaaggttcgtagcagc |
39300087 |
T |
|
| Q |
217 |
agcatgatgatgatccct |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39300088 |
agcatgatgatgatccct |
39300105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 39300106 - 39300174
Alignment:
| Q |
1 |
atcactctgcttcacatttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300106 |
atcactctgcttcacatttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcc |
39300174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University