View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11094_low_17 (Length: 236)
Name: NF11094_low_17
Description: NF11094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11094_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 4 - 218
Target Start/End: Original strand, 47374267 - 47374481
Alignment:
| Q |
4 |
ggatttcagagctttgataaggttggtgaatgagaaattgaagcatcgagagggaaatttatctgaagtggtgtgttggtgtatgaaggagagatgttag |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47374267 |
ggatttcagagctttgataaggttggtgaatgagaaattgaagcatcgagagggaaattgatctgaagtggtgtgttggtgtatgaaggagagatgttag |
47374366 |
T |
 |
| Q |
104 |
aataattcagaacatgagacataagcaaagaaagagagaaactaagaaacggcggagagaaggtgatggttgttctccataaacaaaaccaaaccctagt |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
47374367 |
aataattcagaacatgagacagaagcaaagaaagagagaaactaagaaacggcggaaagaaggtgatggatgttctccataaacaaaatcaaaccctagt |
47374466 |
T |
 |
| Q |
204 |
tttgttttacattgt |
218 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47374467 |
tttgttttacattgt |
47374481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University