View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11094_low_9 (Length: 368)
Name: NF11094_low_9
Description: NF11094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11094_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 13 - 359
Target Start/End: Complemental strand, 43118100 - 43117758
Alignment:
| Q |
13 |
aattatccatcatatcttgcagaatttatcttcaattctgaatcagcgtacgttgttttttcagattcagaattgattgacgttcctatttccaatccca |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43118100 |
aattatccatcatatcttgcagaaattatcttcaattctgaatcagcgtacgttgttttttcagattcagaattgattgacgttcctatttccaatccca |
43118001 |
T |
|
| Q |
113 |
attgtcagttggctctcgtatttggatttccaatcgtcattgcattatgagattctacaccgcccgttacatttcaagaatataaccatgttcatgaaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43118000 |
attgtcagttggctctcgtatttggatttccaatcgtcattgcattatgagattctacaccgcccgttacatttcaagaatataaccatgttcatgaaat |
43117901 |
T |
|
| Q |
213 |
tggaaattcttcctgcatcaaggtggttgcttagggcgtgcttcaggtcttcaattattctctgcaacatatatatgatacaacatgatatccacaagct |
312 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43117900 |
tggaaattgttcctgcatcaaggtggttgcttagggcgtgcttcaggtcttcaattattctctgcaac----atatgatacaacatgatatccacaagct |
43117805 |
T |
|
| Q |
313 |
tgacttcagaatacatgcagatgacaatgaaactataacaatctctg |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43117804 |
tgacttcagaatacatgcagatgacaatgaaactataacaatctctg |
43117758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University