View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_high_18 (Length: 435)
Name: NF11095_high_18
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 10 - 420
Target Start/End: Original strand, 33162391 - 33162801
Alignment:
| Q |
10 |
gcagagaggctttgatgattgtaaagactgttttgatctcaacggccgggagaagcaccgttggacaaaccctagatcgaaaggtctagatttcagtatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
33162391 |
gcagagaggctttgatgattgtaaagactgttttgatctcaacggccgtgagaagcaccgttggacaaaccctagatcaaacggtctagatttcagtatc |
33162490 |
T |
|
| Q |
110 |
gatgatgttttagaaacacgtaaacccggttcgattcgaatcggtttagacataggtgggggagtagcaactttcgcggttcgaatgaaagatagaaaca |
209 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162491 |
gacgatgttttagaaacacgtaaacccggttcggttcgaatcggtttagacataggtggtggagtagcaactttcgcggttcgaatgaaagatagaaaca |
33162590 |
T |
|
| Q |
210 |
ttacaattataacaacgtcgttaaacttaaacggtccttttaatagcttcatagcttcaagaggggttgttcctttatacatgagtatttcacaacggtt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
33162591 |
ttacaattataacaacgtcgttaaacttaaacggtccttttaatagcttcatagcttcaagaggggttcttcctttatatatgagtatttcacaacggtt |
33162690 |
T |
|
| Q |
310 |
tccnnnnnnngataacactttggatatagttcattccatgcatgttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttat |
409 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162691 |
tccgttttttgataacactttggatatagttcattccatgcatgttttgagtaattggataccagaaacattgcttcattttttgttgtttgatgtttat |
33162790 |
T |
|
| Q |
410 |
agggttcttag |
420 |
Q |
| |
|
||||||||||| |
|
|
| T |
33162791 |
agggttcttag |
33162801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University