View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_high_21 (Length: 405)
Name: NF11095_high_21
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 20 - 338
Target Start/End: Complemental strand, 42553628 - 42553310
Alignment:
| Q |
20 |
aacccaatagagaggagctttacagcatgagacgggtaacaatcatccctcagtttaggaatcacattacaaggtagacttcataatcacgaagtctctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553628 |
aacccaatagagaggagctttacagcatgagacgggtaacaatcatccctcagcttaggaatcacattacaaggtagacttcataatcacgaagtctctt |
42553529 |
T |
 |
| Q |
120 |
tagaagaacactaaaaacaaaaccaatgtagacttcatcgattcaatcattttttaactaaaaaccattcctattgacgtttagcttcgttaagtgtttt |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553528 |
tagaagaacactaaaaaccaaaccaatgtagacttcatcgattcaatcattttttaactaaaaaccattcctattgacgtttagcttcgttaagtgtttt |
42553429 |
T |
 |
| Q |
220 |
ggttgaattttaagtaatacatggagtctctttagaaattacccatctcctttcaaaagtgaagtttattgttttgggcctctcaagcccacacgaaaag |
319 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42553428 |
ggttgaattttaagtaatacagggagtctctttagaaattacccatctccattcaaaagtgaagtttattgttttgggcctctcaagcccacacgaagag |
42553329 |
T |
 |
| Q |
320 |
gtttcaacacaaacgccgt |
338 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42553328 |
gtttcaacacaaacgccgt |
42553310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 355 - 397
Target Start/End: Complemental strand, 42553291 - 42553249
Alignment:
| Q |
355 |
tcgtgccgcaaaaccacagagaaacgaagctagggttcatctc |
397 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
42553291 |
tcgtaccgcaaaaccacagggaaacgaagctagggtttatctc |
42553249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University