View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_high_24 (Length: 327)
Name: NF11095_high_24
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 109 - 309
Target Start/End: Complemental strand, 37879352 - 37879141
Alignment:
| Q |
109 |
ataaaaagtttattataatacattcttcaatctagaattgttgttgaatgattgaaattgtggtgtaatttacaggcttatactactgagcttgagagcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879352 |
ataaaaagtttattataatacattcttcaatctagaattgttgttgaatgattgaaattgtggtgtaatttacaggcttatactactgagcttgagagcc |
37879253 |
T |
|
| Q |
209 |
tggttaagcgtttggagatagagaataagcagttagaagaagaacaggtgcg-----------tattgttattgttatgcatttattaatgtgttgtgtt |
297 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879252 |
tggttaagcatttggagatagagaataagcagttagaagaagaacaggtgcggttatattggttattgttattgttatgcatttattaatgtgttgtgtt |
37879153 |
T |
|
| Q |
298 |
ttttggtaatgt |
309 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37879152 |
ttttggtaatgt |
37879141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 14 - 64
Target Start/End: Complemental strand, 37879447 - 37879397
Alignment:
| Q |
14 |
gaatgatcaagaatcgtgagtctgctgctaggtcgagagaacgcaaacagg |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37879447 |
gaatgatcaagaatcgtgagtctgctgctaggtcaagagaacgcaaacagg |
37879397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University