View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_high_26 (Length: 315)
Name: NF11095_high_26
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 48 - 311
Target Start/End: Complemental strand, 9692622 - 9692360
Alignment:
| Q |
48 |
tcattgttgccggtcacaatcatgtcaccaacatatttagcttacaattagtttgtgcttatttgttgagtttttgcagtataagatatgcacatgtaca |
147 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692622 |
tcattgttgccggtcacaatcacgtcaccaacatatt-agcttacaattagtttgtgcttatttgttgagtttttgcagtataagatatgcacatgtaca |
9692524 |
T |
 |
| Q |
148 |
cattttacaaaaccttgttgaagaaggaacccatcgatcttcttgttccatgctctaggtgtctgatatgagccatacagagatttcttcaatttgtaca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692523 |
cattttacaaaaccttgttgaagaaggaaccaatcgatcttcttgttccatgctctaggtgtctgatatgagccatacagagatttcttcaatttgtaca |
9692424 |
T |
 |
| Q |
248 |
agcaattttccttgcctttttcatcaaaacatgatggttgagtcacatatacttcttctctctc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9692423 |
agcaattttccttgcctttttcatcaaaacatgatggttgagtcacatatacttcttctatctc |
9692360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 95 - 211
Target Start/End: Complemental strand, 29997360 - 29997244
Alignment:
| Q |
95 |
ttagtttgtgcttatttgttgagtttttgcagtataagatatgcacatgtacacattttacaaaaccttgttgaagaaggaacccatcgatcttcttgtt |
194 |
Q |
| |
|
||||||| | ||||||||| | |||| ||| ||||| | ||||| ||| ||||||||| ||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
29997360 |
ttagttttttcttatttgtagtgtttatgcggtatatgttatgctcatttacacatttcacaaatccttgttgaagaaggaacccatctattttcttgtt |
29997261 |
T |
 |
| Q |
195 |
ccatgctctaggtgtct |
211 |
Q |
| |
|
||| ||||||| ||||| |
|
|
| T |
29997260 |
ccaagctctagctgtct |
29997244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University