View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_high_36 (Length: 255)
Name: NF11095_high_36
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 5 - 209
Target Start/End: Original strand, 37879540 - 37879744
Alignment:
| Q |
5 |
acggcagaagaagaagaaggatattgattatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879540 |
acggcagaagaagaagaaggatattgatgatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcac |
37879639 |
T |
 |
| Q |
105 |
cgcaagcagaaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879640 |
cgcaagcagaaaaaccttcatcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatc |
37879739 |
T |
 |
| Q |
205 |
gtcaa |
209 |
Q |
| |
|
||||| |
|
|
| T |
37879740 |
gtcaa |
37879744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University