View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_low_12 (Length: 502)
Name: NF11095_low_12
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_low_12 |
 |  |
|
| [»] scaffold0219 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0219 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 291 - 494
Target Start/End: Original strand, 11518 - 11721
Alignment:
| Q |
291 |
ttgctattcgtctaggttaacttcatacttttcatcatagattattttacaatgcatatagaacatggcataacagaattctactgaattctagagtgac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11518 |
ttgctattcgtctagggtaacttcatacttttcatcatagattattttacaatgcatatagaacatggcataacagaattctcctgaattctagagtgac |
11617 |
T |
 |
| Q |
391 |
acttcatgcttattacaattaaaatcgactcatcctaaatagaagaatctatagtatagactatgatgaatactaagttttcttatcatactcatgggcc |
490 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11618 |
atttcatgcttattacaattaaaatcgactcatcctaaatagaagaatctatagtatagactatgatgaatactaagttttcttatcatactcatgggcc |
11717 |
T |
 |
| Q |
491 |
agct |
494 |
Q |
| |
|
|||| |
|
|
| T |
11718 |
agct |
11721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 11234 - 11456
Alignment:
| Q |
7 |
gtttcaccataggacactcgtagataaacaacctcggaagcagatgtctaaggatattcatatgccacaatnnnnnnnnttgtgagatcgaggcaaaacg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| | |
|
|
| T |
11234 |
gtttcaccataggacactcgtagataaacaacctcggaagcagatgtctaaggatattcatatgccacaataaaaaaaattgtgagaccgaggcaaaagg |
11333 |
T |
 |
| Q |
107 |
tgaaaagggtcatatcccttcaggcgattcgcaattcctaaaatgtgttcttgcgtctaaatctcttgacattgctccttgggacattcacaatagatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11334 |
tgaaaagggtcatatcccttcaggcgattcgcaattcctaaaatgtgttcttgcgtctaaatctcttgacattgctccttgggacattcacaatagatga |
11433 |
T |
 |
| Q |
207 |
aacatgaccctctattatgcact |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11434 |
aacatgaccctctattatgcact |
11456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University