View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11095_low_47 (Length: 204)

Name: NF11095_low_47
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11095_low_47
NF11095_low_47
[»] chr5 (1 HSPs)
chr5 (73-190)||(36466132-36466249)


Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 73 - 190
Target Start/End: Complemental strand, 36466249 - 36466132
Alignment:
73 agagatttctaactgtttcgttatattataaaagcttattctcgacgatgaaccatttgtgtcatcatgctcaagctttagatattaatttcaagttatt 172  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
36466249 agagatttctaactgtttcgttatattataaaagcttattctcgacgatgaaccatttgtgtcatcatgctcaagctttagagattaatttcaagttatt 36466150  T
173 ggaagcagttatgatttt 190  Q
    ||||||||||||||||||    
36466149 ggaagcagttatgatttt 36466132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University