View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11095_low_47 (Length: 204)
Name: NF11095_low_47
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11095_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 73 - 190
Target Start/End: Complemental strand, 36466249 - 36466132
Alignment:
| Q |
73 |
agagatttctaactgtttcgttatattataaaagcttattctcgacgatgaaccatttgtgtcatcatgctcaagctttagatattaatttcaagttatt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36466249 |
agagatttctaactgtttcgttatattataaaagcttattctcgacgatgaaccatttgtgtcatcatgctcaagctttagagattaatttcaagttatt |
36466150 |
T |
 |
| Q |
173 |
ggaagcagttatgatttt |
190 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36466149 |
ggaagcagttatgatttt |
36466132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University