View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11096_high_14 (Length: 276)
Name: NF11096_high_14
Description: NF11096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11096_high_14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 276
Target Start/End: Complemental strand, 698896 - 698634
Alignment:
| Q |
14 |
gatgaatacaactacagatgaaaatccaagtagatgagattatatagattcagaggcttagatattttttgtttaaagatgccttaaggttttgtagatt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
698896 |
gatgaatacaactacagatgaaaatccaagtagatgagattatatagattcagaggcttagatattttttgtttaaatatgccttaaggttttgtagatt |
698797 |
T |
 |
| Q |
114 |
ctctctagcatcatagaatggagattattaagatttgaattcatcatgcatcatataccatatcattgtcttaatgtcagaatcatatacatttatataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
698796 |
ctctctagcatcatagaatggagattattaagatttgaattcatcatgcatcatataccatatcattgtcttaatgtcagaatcatatacatttatataa |
698697 |
T |
 |
| Q |
214 |
aaaggagtttgaaaattaaatttaaatgtaaaagcaattgcagagataaaagtttcaaattct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
698696 |
aaaggagtttgaaaattaaatttaaatgtaaaagcaattgcagagataaaagtttcatattct |
698634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University