View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11096_low_19 (Length: 221)
Name: NF11096_low_19
Description: NF11096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11096_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 79 - 211
Target Start/End: Complemental strand, 4620534 - 4620402
Alignment:
| Q |
79 |
accctgtacctatgtatcataggttatcattggttttgcnnnnnnngacttgtcagaatgttattcttttgttttgttggtagctagcatactgaaagta |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4620534 |
accctgtacctatgtatcataggttatcattggttttgctttttttgacttgtcaaaatgttattcttttgttttgttggtagctagcatactgaaagta |
4620435 |
T |
 |
| Q |
179 |
atttattttactaatgtcctgttgttttctgtg |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
4620434 |
atttattttacttatgtcctgttgttttctgtg |
4620402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University