View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11098_high_12 (Length: 246)
Name: NF11098_high_12
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11098_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 4914016 - 4913828
Alignment:
| Q |
19 |
aggactatgtggaatgaagaatatgctggaacttgacctcagct---atacaatgagtggtcattttcatcattgccttagcaacttgacaaaccttaga |
115 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||||| || |||||||||| |||||| ||| |||||||| |||||||||| ||| ||| |
|
|
| T |
4914016 |
aggattatgtggaatgaagaatctgcaggaacttgacctcagcagaaatggaatgagtggttattttcctcaatgccttagaaacttgacaagcctcaga |
4913917 |
T |
 |
| Q |
116 |
gtacttgacttgtcatcaactcatttggttggaaacattccatctttcatcactagtctcaagtctctttgaatatctatctctctttga |
205 |
Q |
| |
|
|||||||| || || |||| | |||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4913916 |
gtacttgatttatcctcaaataattttgttggaaacattccatctttcatcattagtctcaagtctc-ttgaatatctatctctctttga |
4913828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 26 - 205
Target Start/End: Complemental strand, 32747020 - 32746839
Alignment:
| Q |
26 |
tgtggaatgaagaatatgctggaacttgacctcagct---atacaatgagtggtcattttcatcattgccttagcaacttgacaaaccttagagtacttg |
122 |
Q |
| |
|
|||| |||||||||| | | |||||||||||||||| ||| |||||||||| |||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
32747020 |
tgtgaaatgaagaatttacaggaacttgacctcagcagaaatagaatgagtggtgattttccacattgccttagcaacttgacaaacctccaagtacttg |
32746921 |
T |
 |
| Q |
123 |
acttgtcatcaactcatttggttggaaacattccatctttcatcactagtctcaagtctctttgaatatctatctctctttga |
205 |
Q |
| |
|
| || || || | | |||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32746920 |
atttatcctccaataattttgttggaaatattccatctttcatcactagtctcaagtctc-ttgaatatctatctctctttga |
32746839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 2126835 - 2126792
Alignment:
| Q |
10 |
gagtagcataggactatgtggaatgaagaatatgctggaacttg |
53 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2126835 |
gagtaccacaggactatgtggaatgaagaatatgctggaacttg |
2126792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University