View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11098_high_14 (Length: 239)
Name: NF11098_high_14
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11098_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 45710301 - 45710511
Alignment:
| Q |
14 |
gaagccaacgatgacggtactggcgatggaaatggaagcgagttgaacgtcgccaaggtgaccggcaaaggcttgagtaacgacgttcatggtgaaagat |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45710301 |
gaagccaacgatgacggtattggcgatggaaatggaagcgagttgaacgtcaccaaggtgaccggcaaaggcttgagtaacgacgttcatggtgaaagat |
45710400 |
T |
 |
| Q |
114 |
gcgacgcggctgaaaatagagggaccaactatgtgccatagtttcttcgtttcaatccatagtttcttgccaaattcttgttcatcatcatcctcatgtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45710401 |
gcgacgcggctgaaaatagagggaccaactatgtgccatagtttcttcgtttcaaaccatagtttcttgccaaattcttgttcatcatcatcctcatgtt |
45710500 |
T |
 |
| Q |
214 |
gatgttcgtta |
224 |
Q |
| |
|
|||||| |||| |
|
|
| T |
45710501 |
gatgtttgtta |
45710511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University