View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11098_high_17 (Length: 223)
Name: NF11098_high_17
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11098_high_17 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 32 - 223
Target Start/End: Complemental strand, 35368095 - 35367903
Alignment:
| Q |
32 |
tagactacttttttgtt-aaggagaaactagactacctataaagcattaataacttataacataactaaacccttaagccttttctaagttactggggag |
130 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35368095 |
tagactacttttttttttaaggagaaactagactacctatgaagcattaataacttataacataactaaatccttacaccttttctaagttactggggag |
35367996 |
T |
 |
| Q |
131 |
tggggagtgacctctctgtcacatctataatcatagagggattgagagaacagttagagcgacacaaaagacaattagggtttttacgaagcc |
223 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
35367995 |
tggagagtgacctctgtgtcacatctataatcatagagagattgagagaacagttagagcgacacagaggacaattggggtttttacgaagcc |
35367903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 117 - 223
Target Start/End: Complemental strand, 35374950 - 35374844
Alignment:
| Q |
117 |
aagttactggggagtggggagtgacctctctgtcacatctataatcatagagggattgagagaacagttagagcgacacaaaagacaattagggttttta |
216 |
Q |
| |
|
||||||| |||||||| ||||||| ||||| | |||||||||||| |||||| |||||||| ||| | |||||||| | | |||||||||| |||||| |
|
|
| T |
35374950 |
aagttaccggggagtgaggagtgatctctccggcacatctataattatagagtgattgagatgacaactggagcgacatagaggacaattaggtttttta |
35374851 |
T |
 |
| Q |
217 |
cgaagcc |
223 |
Q |
| |
|
||||||| |
|
|
| T |
35374850 |
cgaagcc |
35374844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University