View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11098_low_14 (Length: 239)

Name: NF11098_low_14
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11098_low_14
NF11098_low_14
[»] chr3 (1 HSPs)
chr3 (14-224)||(45710301-45710511)


Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 45710301 - 45710511
Alignment:
14 gaagccaacgatgacggtactggcgatggaaatggaagcgagttgaacgtcgccaaggtgaccggcaaaggcttgagtaacgacgttcatggtgaaagat 113  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
45710301 gaagccaacgatgacggtattggcgatggaaatggaagcgagttgaacgtcaccaaggtgaccggcaaaggcttgagtaacgacgttcatggtgaaagat 45710400  T
114 gcgacgcggctgaaaatagagggaccaactatgtgccatagtttcttcgtttcaatccatagtttcttgccaaattcttgttcatcatcatcctcatgtt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
45710401 gcgacgcggctgaaaatagagggaccaactatgtgccatagtttcttcgtttcaaaccatagtttcttgccaaattcttgttcatcatcatcctcatgtt 45710500  T
214 gatgttcgtta 224  Q
    |||||| ||||    
45710501 gatgtttgtta 45710511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University