View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11098_low_15 (Length: 239)
Name: NF11098_low_15
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11098_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 219
Target Start/End: Complemental strand, 52537099 - 52536887
Alignment:
| Q |
7 |
gtaaatggaaacacctgatatttggggatgaagctgaaactgctgacatcaatgcttgccataagagatgtaccgaaatcagaaaaggaagaaccacagc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52537099 |
gtaaatggaaacacctgatatttggggatgaagctgaaactgctgacatcaatgcttgccataagagatgtaccgaaatcagaaaaggaagaaccacagc |
52537000 |
T |
 |
| Q |
107 |
tttcttcattgccgttaatggtgacgtatgaagaagaagactgaaaaaccaggagagaagagtaaggatcgttaataaacttcaccgtttcttcccaatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52536999 |
tttcttcattgccgttaatggtgacgtatgaagaagaagactgaaaaaccagcagagaagagtaaggatcgttaataaacttcaccgtttcttcccaatc |
52536900 |
T |
 |
| Q |
207 |
ctcttgtaacaga |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52536899 |
ctcttgtaacaga |
52536887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University