View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11098_low_9 (Length: 260)
Name: NF11098_low_9
Description: NF11098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11098_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 5025480 - 5025707
Alignment:
| Q |
15 |
cataggccgcggagagtcgatgtgtttcaagattcgacccttcttttcctctttagccagagtttttaccgataatctttgtgcgtctttatgcatcgag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5025480 |
cataggccgcggagagtcgatgtgtttcaagattcgacccttcttttcctctttagccagagtttttaccgataatctttgtgcgtctttatgcatcgag |
5025579 |
T |
|
| Q |
115 |
tctttgacaatatcatggaaattaggtgattgatttctttggttgtcatgttgcttcgctgctgcttctgaattggaattttctgtggttttcattggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5025580 |
tctttgacaatatcatggaaattaggtgattgatttctttggttgtcatgttgcttcgctgctgcttctgaattggaattttctgtggttttcattggac |
5025679 |
T |
|
| Q |
215 |
ttatcgatggtggttctatatgtattgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5025680 |
ttatcgatggtggttctatatgtattgt |
5025707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University