View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11099_low_13 (Length: 265)
Name: NF11099_low_13
Description: NF11099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11099_low_13 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 265
Target Start/End: Original strand, 27465004 - 27465258
Alignment:
| Q |
11 |
taggaattgagataacggatattgcaaagacaaaagcatagtgggattgagacaaacgatgaatattcaaaaggttatacataggatgagaattataagt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27465004 |
taggaattgagataacggatattgcaaagacaaaagcatagtgggattgagacaaaccatgaaaattcaaaaggttatacataggatgagaattataagt |
27465103 |
T |
|
| Q |
111 |
aatctgtttaccttttacgaagagcaatatgtaagtcaatcgaaggatcaggtgggaccacagttgggcaaaggattggaaccgaacccgtatcactaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27465104 |
aatctgtttaccttttacgaagagtaatatgtaagtcaatcgaaggatcaggtgggaccacagttgggcaaaggattggaaccgaacccgtatcactaaa |
27465203 |
T |
|
| Q |
211 |
agaggtaggaagattctcttgaactaaattgccaaaatcagttggagcactctct |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27465204 |
agaggtaggaagattctcttgagctaaattgccaaaatcagttggagcactctct |
27465258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 37918314 - 37918356
Alignment:
| Q |
124 |
tttacgaagagcaatatgtaagtcaatcgaaggatcaggtggg |
166 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37918314 |
tttacgaagagcaatatgtaagtcaattgaaggatcaggtggg |
37918356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 161
Target Start/End: Complemental strand, 33833483 - 33833408
Alignment:
| Q |
85 |
ttatacataggatgagaattataagtaatctgtttaccttttacgaagagcaatatgtaagtcaatcgaaggatcag |
161 |
Q |
| |
|
||||| |||||||||| |||| ||||| | | |||||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
33833483 |
ttataaataggatgaggattagaagtagaccggttaccttt-acgaagagcaataggtaagtcaattgaaggatcag |
33833408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University