View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11099_low_18 (Length: 240)

Name: NF11099_low_18
Description: NF11099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11099_low_18
NF11099_low_18
[»] chr7 (1 HSPs)
chr7 (146-205)||(3063228-3063288)
[»] chr4 (1 HSPs)
chr4 (3-53)||(16874172-16874222)


Alignment Details
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 146 - 205
Target Start/End: Complemental strand, 3063288 - 3063228
Alignment:
146 gttgtttcaagtgtactatgaaatggcttt-ggagtaagcgagcaaccagagaaacaatat 205  Q
    |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
3063288 gttgttgcaagtgtactatgaaatggcttttggagtaagcgagcaaccagagaaacaatat 3063228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 16874222 - 16874172
Alignment:
3 gagagtctcacattggatgagagacgacttgaaaatgtgtttttataagtg 53  Q
    |||| ||||||||||||||||| | | ||||||||||||||| ||||||||    
16874222 gagattctcacattggatgagatatggcttgaaaatgtgtttatataagtg 16874172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University