View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11099_low_18 (Length: 240)
Name: NF11099_low_18
Description: NF11099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11099_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 146 - 205
Target Start/End: Complemental strand, 3063288 - 3063228
Alignment:
| Q |
146 |
gttgtttcaagtgtactatgaaatggcttt-ggagtaagcgagcaaccagagaaacaatat |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3063288 |
gttgttgcaagtgtactatgaaatggcttttggagtaagcgagcaaccagagaaacaatat |
3063228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 16874222 - 16874172
Alignment:
| Q |
3 |
gagagtctcacattggatgagagacgacttgaaaatgtgtttttataagtg |
53 |
Q |
| |
|
|||| ||||||||||||||||| | | ||||||||||||||| |||||||| |
|
|
| T |
16874222 |
gagattctcacattggatgagatatggcttgaaaatgtgtttatataagtg |
16874172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University