View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_high_10 (Length: 252)
Name: NF1109_high_10
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 31 - 235
Target Start/End: Original strand, 41299302 - 41299521
Alignment:
| Q |
31 |
attcattctccaaaggctctcaacatcaaacaagttcattggcattctcctataatttcttggacaaaatgcaatatt-----ggcagctagaggttttt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41299302 |
attcattctccaaaggctctcaacatcaaacaggttcattggcattctcctataatttcttggacaaaatgcaatattgacaaggcagctagaggttttt |
41299401 |
T |
 |
| Q |
126 |
cttgtccttctgcttgcgagggtatcattagggatcaccatgcaaa----------tcttttcctgtcaacattggtaataatacttcctttaatgttga |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299402 |
ctggtccttctgcttgcgagggtatcattagggatcaccatgcaaatgtttatggttgttttcctgtcaacattggtaataatacttcctttaatgttga |
41299501 |
T |
 |
| Q |
216 |
gttaattggatctatgacgg |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41299502 |
gttaattggatctatgacgg |
41299521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University