View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_high_11 (Length: 251)
Name: NF1109_high_11
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 9131865 - 9131641
Alignment:
| Q |
19 |
taagcagtcggtagtaacttgcagctcacacatcttaaggactggcatatatgatgcgatgacaaacacgacacagtaaaacctctatttcgttttcagc |
118 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9131865 |
taagcagtcggtggtaacttggagctcacacatcttaacgactggcatatatgatgcgatgacaaacacgacacagtaaaacctctatttcgttttcaac |
9131766 |
T |
 |
| Q |
119 |
agagggtttagggttttgcaacaatttgggattaccaatgccagaaaataatcccaagaagaaggttaccttctccgaaaacgacgccgcttcaatcaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9131765 |
agagggtttagggttttgcaacaatttgggattaccaatgccagaaaataatcccaagaagaaggttaccttctccgaaaacgacgccgcttcaatcaca |
9131666 |
T |
 |
| Q |
219 |
caacggtattcttcttcttcatctc |
243 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
9131665 |
caacggtattcttcttcttcttctc |
9131641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University