View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1109_high_12 (Length: 232)

Name: NF1109_high_12
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1109_high_12
NF1109_high_12
[»] chr4 (1 HSPs)
chr4 (1-124)||(45992879-45993000)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 45993000 - 45992879
Alignment:
1 tgtgaagattgtaggtgtgggatcatgacttggagttcttttataagttatttaatgttcactagagtggttgattttttgtgtacattagttctgtctc 100  Q
    |||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||    
45993000 tgtgaagattgtaggtg--ggatcatgaattggagttcttttataagttatttaatgtttactagagtggttggttttttgtgtacactagttctgtctc 45992903  T
101 gttgttgcttatgtggtctgtgat 124  Q
    ||||||||||||||||||||||||    
45992902 gttgttgcttatgtggtctgtgat 45992879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University