View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_low_11 (Length: 325)
Name: NF1109_low_11
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 48 - 184
Target Start/End: Complemental strand, 4002277 - 4002141
Alignment:
| Q |
48 |
ggaattcctgtattattgattgatttttgacaatggaatggaatataatgattataatcaggttttcagtctgatagaatggtatgaattatattggaaa |
147 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4002277 |
ggaattactgtattattgattgatttttgacaatggaatggaatataatgattataatcaggttttcagtctgatagaatggtatgaattatattggaaa |
4002178 |
T |
|
| Q |
148 |
atgtttcataggcacccatacattccatatgcacctc |
184 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4002177 |
atgtttcatgggcacccatacattccatatgcacctc |
4002141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University