View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_low_13 (Length: 302)
Name: NF1109_low_13
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 76 - 222
Target Start/End: Complemental strand, 2221179 - 2221033
Alignment:
| Q |
76 |
aaatctaagttcaagtaaggacatgtgcgatacatcagatcgggtagtgtctattggccgagtggagggcagctcaatcctattggtgactatgtgaaat |
175 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2221179 |
aaatctaagttcaagtaaggacatatgtgatacatcagatcgggtagtgtctgttggccgagtggagggcagctcaatcctattggtgactatgtgaaat |
2221080 |
T |
 |
| Q |
176 |
gaaaccttgatggatcagattttgatgacgttggttgtgtttgaatt |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2221079 |
gaaaccttgatggagcagattttgatgacgttggttgtgtttgaatt |
2221033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University