View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_low_24 (Length: 232)
Name: NF1109_low_24
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 45993000 - 45992879
Alignment:
| Q |
1 |
tgtgaagattgtaggtgtgggatcatgacttggagttcttttataagttatttaatgttcactagagtggttgattttttgtgtacattagttctgtctc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
45993000 |
tgtgaagattgtaggtg--ggatcatgaattggagttcttttataagttatttaatgtttactagagtggttggttttttgtgtacactagttctgtctc |
45992903 |
T |
|
| Q |
101 |
gttgttgcttatgtggtctgtgat |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45992902 |
gttgttgcttatgtggtctgtgat |
45992879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University