View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1109_low_25 (Length: 230)
Name: NF1109_low_25
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1109_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 38548816 - 38548716
Alignment:
| Q |
16 |
aaatatcacgttagaaatcaataggctcggtcactaatctatttgttaacacacatgtgctttgaatttaacgttggacttgaaatgtatattcttggag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
38548816 |
aaatatcacgttagaaatcaataggctcggtcactaatctatttgttaacacacatgtgctttgaatttaacgttggacttgaaatgtatgtttttggag |
38548717 |
T |
|
| Q |
116 |
a |
116 |
Q |
| |
|
| |
|
|
| T |
38548716 |
a |
38548716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University