View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11100_low_11 (Length: 236)
Name: NF11100_low_11
Description: NF11100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11100_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 43150816 - 43150612
Alignment:
| Q |
11 |
gagatgaaccagcatatacatgaacgtatatcaaacacattatattatgtacgttttttattgactttgaattaatgaacagtgcctattctcatgaaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150816 |
gagatgaaccagcatatacatgaacgtatatcaaacacattat-----gtacgttttttattgactttgaattaatgaacagtgcctattctcatgaaca |
43150722 |
T |
 |
| Q |
111 |
agctataatgctagaactatatagtagtaagtcttatgcatacatatgtcacattaatatggttggatgagtttatatgttttcttaattgactttgaag |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150721 |
agctattatgctagaactatatagtagtaagtcttatgcatacatatgtcacattaatatggttggatgagtttatatgttttcttaattgactttgaag |
43150622 |
T |
 |
| Q |
211 |
tattgatgtt |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
43150621 |
tattgatgtt |
43150612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University