View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11101_high_13 (Length: 240)

Name: NF11101_high_13
Description: NF11101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11101_high_13
NF11101_high_13
[»] chr1 (3 HSPs)
chr1 (18-140)||(49657414-49657536)
chr1 (183-239)||(49657580-49657637)
chr1 (52-90)||(49657398-49657436)
[»] chr5 (1 HSPs)
chr5 (195-240)||(31023392-31023438)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 140
Target Start/End: Original strand, 49657414 - 49657536
Alignment:
18 agtgacacttttttaggtggatatatgacactcaaggtggataacacattagtgacacatttttaggtggataacacattagtagacatggaaatggggt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
49657414 agtgacacttttttaggtggatatatgacactcaaggtggataacacattagtgacacatttttaggtggataacacattagtagacatggaaacggggt 49657513  T
118 tggtcagggacgggttttagcat 140  Q
    ||||| |||||||||||||||||    
49657514 tggtcggggacgggttttagcat 49657536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 49657580 - 49657637
Alignment:
183 aacctgtcgagaatagaaaattcacacccaaacctg-ccccaacggagacgggtttcc 239  Q
    ||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||    
49657580 aacctgttgagaatagaaaattcacacccaaacctgcccccaatggagacgggtttcc 49657637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 90
Target Start/End: Original strand, 49657398 - 49657436
Alignment:
52 aggtggataacacattagtgacacatttttaggtggata 90  Q
    |||||||||||||||||||||||| ||||||||||||||    
49657398 aggtggataacacattagtgacacttttttaggtggata 49657436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 31023438 - 31023392
Alignment:
195 atagaaaattcacacccaaacctgcccc-aacggagacgggtttccc 240  Q
    |||||||||||||||||||| | ||||| ||||||||||||||||||    
31023438 atagaaaattcacacccaaatccgcccccaacggagacgggtttccc 31023392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University