View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11101_low_14 (Length: 241)
Name: NF11101_low_14
Description: NF11101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11101_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 103 - 241
Target Start/End: Complemental strand, 35696442 - 35696304
Alignment:
| Q |
103 |
ctcggcgggttgcaagaggctgattgattcagtacacatgtttttaaccgccgttgtttttgttgtaattagtacattgtgatgatgattgtagtaataa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696442 |
ctcggcgggttgcaagaggctgattgattcagtacacatgtttttaaccgccgttgtttttgttgtaattagtacattgtgatgatgattgtagtaataa |
35696343 |
T |
 |
| Q |
203 |
tttacttatttcattcttcaatcaaaaataatcatttct |
241 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35696342 |
tttacttacttcattgttcaatcaaaaataatcatttct |
35696304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University