View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11101_low_15 (Length: 240)
Name: NF11101_low_15
Description: NF11101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11101_low_15 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 140
Target Start/End: Original strand, 49657414 - 49657536
Alignment:
| Q |
18 |
agtgacacttttttaggtggatatatgacactcaaggtggataacacattagtgacacatttttaggtggataacacattagtagacatggaaatggggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
49657414 |
agtgacacttttttaggtggatatatgacactcaaggtggataacacattagtgacacatttttaggtggataacacattagtagacatggaaacggggt |
49657513 |
T |
 |
| Q |
118 |
tggtcagggacgggttttagcat |
140 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
49657514 |
tggtcggggacgggttttagcat |
49657536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 183 - 239
Target Start/End: Original strand, 49657580 - 49657637
Alignment:
| Q |
183 |
aacctgtcgagaatagaaaattcacacccaaacctg-ccccaacggagacgggtttcc |
239 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
49657580 |
aacctgttgagaatagaaaattcacacccaaacctgcccccaatggagacgggtttcc |
49657637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 90
Target Start/End: Original strand, 49657398 - 49657436
Alignment:
| Q |
52 |
aggtggataacacattagtgacacatttttaggtggata |
90 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49657398 |
aggtggataacacattagtgacacttttttaggtggata |
49657436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 240
Target Start/End: Complemental strand, 31023438 - 31023392
Alignment:
| Q |
195 |
atagaaaattcacacccaaacctgcccc-aacggagacgggtttccc |
240 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
31023438 |
atagaaaattcacacccaaatccgcccccaacggagacgggtttccc |
31023392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University