View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11101_low_17 (Length: 213)
Name: NF11101_low_17
Description: NF11101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11101_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 45382472 - 45382318
Alignment:
| Q |
18 |
tattcattatcacccatgtgctgtatcaaagacaaagtttcctattaacatattatttggtattataaatcataacatattttggatgcataaaaaagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382472 |
tattcattatcacccatgtgctgtatcaaagacaaagtttcctattaacatattatttggtattataaatcataacatattttggatgcataaaaaagta |
45382373 |
T |
|
| Q |
118 |
tatgaaataatgcaccttgttgctttagttatgatctctttggtacaacgatctc |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382372 |
tatgaaataatgcaccttgttgctttagttatgatctctttggtacaacgatctc |
45382318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University