View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11102_high_11 (Length: 249)
Name: NF11102_high_11
Description: NF11102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11102_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 249
Target Start/End: Original strand, 8846324 - 8846579
Alignment:
| Q |
5 |
caccttcctatgacggtatattttctttgacatttaacaaattggttgcaaatagtgatggaa-----------taggcttttgccaatcattgaaaact |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8846324 |
caccttcctatgacggtatattttctttaacatttaacaaattggttgcaaatagtgatggaaataaagatgcataggcttttgccaatcattgaaaact |
8846423 |
T |
 |
| Q |
94 |
tcttatattgatgttgcaggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatgtcttatttttgaaggtgaattcaagctttt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8846424 |
tcttatattgatgttgcaggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatgtcatatttttgaaggtgaattcaagctttt |
8846523 |
T |
 |
| Q |
194 |
atattaataatctatttagtttttctttaacatttaatagttctttcaaacgattc |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8846524 |
atattaataatctatttaatttttctttaacatttaatagttctttcaaacgattc |
8846579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 49098393 - 49098341
Alignment:
| Q |
111 |
aggtgtgacacatgtgggaggagatatgtttgagagtgttcctgatggagatg |
163 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
49098393 |
aggtgtggaacatgtggggggagatatgtttgagagcgttcctgctggggatg |
49098341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University