View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11102_low_13 (Length: 227)
Name: NF11102_low_13
Description: NF11102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11102_low_13 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 3010408 - 3010183
Alignment:
| Q |
1 |
tggaaactggaacatataggtactagagcaaatctgaattccatcaaattgggttttccatttggagtaacaataatggcaatgacactatatgtgcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3010408 |
tggaaactggaacatataggtactagagcagatctgaattccatcaaattgggttttccatttagagtaacaataatggcaatgacactatatgtgcact |
3010309 |
T |
|
| Q |
101 |
aatgttcacattgctctttagtgaacatgttgggaaaattggattgtaaccnnnnnnnnnnagagttggtaaccgaaatactaatttggtcataaaccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3010308 |
aatgttcacattgctctttagtgaacatgttgggaaaattggattgtaacc-tttttttttagagttggtaaccgaaatacttatttggtcataaaccca |
3010210 |
T |
|
| Q |
201 |
aataaaatatgtctgggcacattcaca |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3010209 |
aataaaatatgtctgggcacattcaca |
3010183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 132
Target Start/End: Complemental strand, 3019131 - 3019051
Alignment:
| Q |
51 |
gggttttccatttggagtaacaataatggcaatgacactatatgtgcactaatgttcacattgctctttagtgaacatgttg |
132 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| | ||| ||||| || ||||||||||||||||| |||||||||| |
|
|
| T |
3019131 |
gggtttttcatttggagtaacaataatggcaatgaca-tttatatgcaccaacgttcacattgctctttaaagaacatgttg |
3019051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University