View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11102_low_7 (Length: 348)
Name: NF11102_low_7
Description: NF11102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11102_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 27816167 - 27815843
Alignment:
| Q |
18 |
gtttcaacattctttcaatctccgccacgttcttctctccgttagaatcctcaccacccatgaacaaagaattctcaatctcactcgccgcacctcaggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27816167 |
gtttcaacattctttcaatctccgccacgttcttctctccgttagaatcctcaccacccatgaacaaagaattctcaatctcactcgccgcacctcaggg |
27816068 |
T |
 |
| Q |
118 |
tcagatcgtcggagggtttgtcgtcggtccgttgcttgccgccggtacggtgtttgtcattgctgcttcctttaacaatccgtcttatcataggttgcct |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |
|
|
| T |
27816067 |
tcagatcgttggagggtttgtcgtcggtccgttgcttgccgccggtacggtgtttgtcattgctgcttcctttaacaatccttcttatcatagattacct |
27815968 |
T |
 |
| Q |
218 |
ttagaagaggatgtgaggaataactcagtctccggcggccgtgaagagaagtcgccgccgcagttttctggtggagagtcgtgtatgtatagctctcagc |
317 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27815967 |
ttggaagaggatgtgaggaataactcagtctccggcggctatgaagagaagtcgccgccgcagctttctggtggagagtcgtgtatgtatagctctcagc |
27815868 |
T |
 |
| Q |
318 |
ttccttctgatgtgatttgggctcc |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27815867 |
ttccttctgatgtgatttgggctcc |
27815843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 230
Target Start/End: Original strand, 46201307 - 46201373
Alignment:
| Q |
164 |
acggtgtttgtcattgctgcttcctttaacaatccgtcttatcataggttgcctttagaagaggatg |
230 |
Q |
| |
|
||||||||||| |||||| |||| ||||| |||||||| |||||||||||||| || ||||| |||| |
|
|
| T |
46201307 |
acggtgtttgtgattgcttcttcgtttaataatccgtcgtatcataggttgccgttggaagaagatg |
46201373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University