View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11103_high_13 (Length: 242)
Name: NF11103_high_13
Description: NF11103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11103_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 38713016 - 38713251
Alignment:
| Q |
1 |
caccagtccctaatattttgaagaaaatagttgtagtccgagttgcaacacaagtatgatataagaatgcctcacgttaatttaataatgcacgtgaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38713016 |
caccagtccctaatattttgaagaaaatagttgtagtccgagttgcaacacaagtatgatataagaatgcctcacgttaatttaataatgcacgtgaccg |
38713115 |
T |
 |
| Q |
101 |
tgacaaaacaaaacatatttttccaaggaaatggattctctccagtgaaaatctctcaccttttctcccgcgagacaatccacgcccttaaacaccttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38713116 |
ggacaaaacaaaacatatttttccaaggaaatggattctctgcggtgaaaatctctcaccttttctcccgagagacaatccacgcccttaaacaccttat |
38713215 |
T |
 |
| Q |
201 |
cgtttctatttttaatatttaaagcccttctgactt |
236 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38713216 |
cgtttctatttttaatattcaaagcccttctgactt |
38713251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University