View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11104_low_1 (Length: 263)
Name: NF11104_low_1
Description: NF11104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11104_low_1 |
 |  |
|
| [»] scaffold1801 (1 HSPs) |
 |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0902 (1 HSPs) |
 |  |  |
|
| [»] scaffold1652 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1801 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: scaffold1801
Description:
Target: scaffold1801; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 263
Target Start/End: Complemental strand, 751 - 505
Alignment:
| Q |
14 |
agaagcaggatattatgagccttttttaaatagcatgtttgacctaaagagtaagaaaataatctttaacaaaagcacagttttaaacagttactcagat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
751 |
agaagcaggatattatgagccttttttaaataacatgtttgacctaaagagtaagaaaataatctttaacaaaagcacagttttaaacagttactcagat |
652 |
T |
 |
| Q |
114 |
cattagaagaaacaaaacaaaggaggattttgttagactgcttatgatagcaattatgggcagttatgtttttattatgcgtgtgtttctgtttagaatc |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
651 |
cattagaagaaacaaaacaaagga---ttttgttagactgcttatgatagcaattatgggcagttatgtttttattatgcgtgtgtttctgtttagaatc |
555 |
T |
 |
| Q |
214 |
aaagtattttgtttttgttttgcactttcactagggctagcggtcgttgt |
263 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
554 |
aaaggattttgtttttgttttgcactttcactagggctagcggtcgttgt |
505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 180 - 261
Target Start/End: Complemental strand, 2049 - 1968
Alignment:
| Q |
180 |
tgtttttattatgcgtgtgtttctgtttagaatcaaagtattttgtttttgttttgcactttcactagggctagcggtcgtt |
261 |
Q |
| |
|
||||||||| |||||| |||||||| |||||||||||| ||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
2049 |
tgtttttatcatgcgtatgtttctgcttagaatcaaaggattgtgtttctgttttgcactttcactaaggctagcggtcgtt |
1968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0902 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0902
Description:
Target: scaffold0902; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 205
Target Start/End: Original strand, 2723 - 2782
Alignment:
| Q |
146 |
ttagactgcttatgatagcaattatgggcagttatgtttttattatgcgtgtgtttctgt |
205 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
2723 |
ttagactgcttatgatagtgattatcggcagttatgtttttattatgtgtgtgtttctgt |
2782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1652 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold1652
Description:
Target: scaffold1652; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 191
Target Start/End: Complemental strand, 1213 - 1159
Alignment:
| Q |
137 |
aggattttgttagactgcttatgatagcaattatgggcagttatgtttttattat |
191 |
Q |
| |
|
|||||| ||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1213 |
aggattgtgttagactgcatatgatagcgattacgggcagttatgtttttattat |
1159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 14247740 - 14247779
Alignment:
| Q |
16 |
aagcaggatattatgagccttttttaaatagcatgtttga |
55 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14247740 |
aagcaggatattatgagccttttttaaacagcatgtttga |
14247779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 14316270 - 14316309
Alignment:
| Q |
16 |
aagcaggatattatgagccttttttaaatagcatgtttga |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
14316270 |
aagcaggatattttgagccttttttaaacagcatgtttga |
14316309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University