View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11104_low_4 (Length: 239)
Name: NF11104_low_4
Description: NF11104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11104_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 29462758 - 29462630
Alignment:
| Q |
94 |
tatataatctctgccttcggccaattattgatcttaattnnnnnnnnnntcttgagagtgatcttaattattctttaactatttgagtttaacagcacac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29462758 |
tatataatctctgccttcggccaattattgatcttaattaaaaaaaaa-tcttgagagtgatcttaattattctttaactatttgagtttaacagcacaa |
29462660 |
T |
 |
| Q |
194 |
ataattaagttccactatattatttataag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29462659 |
ataattaagttccactatattatttataag |
29462630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 29462880 - 29462783
Alignment:
| Q |
1 |
ataatattattttgttcgtttaagttcaataccttttttgacaaaaatgagtgggaatatataaaatcgtaatgtaagggcccagtcacatgatatata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
29462880 |
ataatattattttgttcgtttaagttcaataccttttttgacaaaaatgagtgggaatatataaaatcgtattgtaa-ggcccagtcacatgatatata |
29462783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University